Bio Design & Bio Fabrication (Suzanne Lee, Christina Agapakis) Lab: (Final Project work)
Course Application
Anyone, anywhere can sign up to take HTGAA as a Global Student, online and free of charge!
Enrolled MIT/Harvard students can apply to take the course for credit as MAS.885 in the MIT course catalog.
No prior background is required or assumed.
The Spring 2026 semester of HTGAA is under way and applications are closed.
Applications for future semesters will open typically in January and August.
Subsections of HTGAA Spring 2026
Course Logistics
Schedule / Location
Tuesdays, 2–5 PM ET
Room: MIT E15-359 & Zoom
Slides/recordings: linked from each week page after class
Wednesdays, 5–7 PM ET
Room: MIT E15-359 & Zoom
Slides/recordings: linked from each week page after recitation
Global recitations are organized locally by each node (via Zoom).
Contact your Node lead for times and links.
Thursdays and Fridays, 2-5 PM ET
Room: 68-083
Week-specific sessions and protocols appear on each week’s Lab page.
Available upon request. Coordinate directly with the teaching team.
For registered MIT and Harvard students taking this class in person and
for credit (MIT course MAS.885), grades will be determined using the following rubric:
Component
Percentage
Lecture, Recitation, and Lab Attendance and Participation
33%
Weekly Assignments (Class Write-ups and Lab Documentation)
33%
Final Project (Group work and individual project)
34%
Committed Listeners are assessed on participation, homework, and final project presentation;
those meeting the standards are awarded a signed Certificate of Completion at the end of the course.
Contact your Global Node for grading details.
Make sure to document every step of the in-silico and lab experiments. Make sketches, screenshots, notes, drawings - anything that helps you - and others understand the experiment.
Your Documentation should help you - and others - to understand the topic. Don’t be afraid to add things that don’t work. Show your failures - and how you overcame them. Your Documentation should be a description of the amazing journey you are on!
Overview
Ethics, safety, and security are essential considerations throughout (and beyond!) this class. We have therefore designed the Class Assignment this week to give you a strong foundation, and then will ask you to reflect each week and in the design of your final project.
First, describe a biological engineering application or tool you want to develop and why. This could be inspired by an idea for your HTGAA class project and/or something for which you are already doing in your research, or something you are just curious about.
Next, describe one or more governance/policy goals related to ensuring that this application or tool contributes to an “ethical” future, like ensuring non-malfeasance (preventing harm). Break big goals down into two or more specific sub-goals. Below is one example framework (developed in the context of synthetic genomics) you can choose to use or adapt, or you can develop your own. The example was developed to consider policy goals of ensuring safety and security, alongside other goals, like promoting constructive uses, but you could propose other goals for example, those relating to equity or autonomy.
Next, describe at least three different potential governance “actions” by considering the four aspects below (Purpose, Design, Assumptions, Risks of Failure & “Success”). Try to outline a mix of actions (e.g. a new requirement/rule, incentive, or technical strategy) pursued by different “actors” (e.g. academic researchers, companies, federal regulators, law enforcement, etc). Draw upon your existing knowledge and a little additional digging, and feel free to use analogies to other domains (e.g. 3D printing, drones, financial systems, etc.).
Purpose: What is done now and what changes are you proposing?
Design: What is needed to make it “work”? (including the actor(s) involved - who must opt-in, fund, approve, or implement, etc)
Assumptions: What could you have wrong (incorrect assumptions, uncertainties)?
Risks of Failure & “Success”: How might this fail, including any unintended consequences of the “success” of your proposed actions?
Next, score (from 1-3 with, 1 as the best, or n/a) each of your governance actions against your rubric of policy goals. The following is one framework but feel free to make your own:
Does the option:
Option 1
Option 2
Option 3
Enhance Biosecurity
• By preventing incidents
• By helping respond
Foster Lab Safety
• By preventing incident
• By helping respond
Protect the environment
• By preventing incidents
• By helping respond
Other considerations
• Minimizing costs and burdens to stakeholders
• Feasibility?
• Not impede research
• Promote constructive applications
Last, drawing upon this scoring, describe which governance option, or combination of options, you would prioritize, and why. Outline any trade-offs you considered as well as assumptions and uncertainties. For this, you can choose one or more relevant audiences for your recommendation, which could range from the very local (e.g. to MIT leadership or Cambridge Mayoral Office) to the national (e.g. to President Biden or the head of a Federal Agency) to the international (e.g. to the United Nations Office of the Secretary-General, or the leadership of a multinational firm or industry consortia). These could also be one of the “actor” groups in your matrix.
Reflecting on what you learned and did in class this week, outline any ethical concerns that arose, especially any that were new to you. Then propose any governance actions you think might be appropriate to address those issues. This should be included on your class page for this week.
Assignment (Final Project) – Due as part of your Final Project presentation (not Feb 10)
Assignees for the following sections
MIT/Harvard students
Required
Committed Listeners
Required
As part of your final project, design one or more strategies to ensure that your project, and what it enables, contributes to growing an ethical biological future.
Assignment (Lab Preparation) — DUE BY START OF FEB 10 LECTURE
Assignees for the following sections
MIT/Harvard students
Required
Committed Listeners
(Not Applicable)
Lab Training (failure to complete this will jeopardize your acceptance into the course)
Complete Lab Specific Training in Person.
Complete Safety Training in Atlas
Navigate to atlas.mit.edu and on the right-hand side, click “Learning Center”
Head to the Course Catalog and find the following two courses:
General Biosafety for Researchers (EHS00260w)
Managing Hazardous Waste (EHS00501w)
Assignment (Week 2 Lecture Prep) — DUE BY START OF FEB 10 LECTURE
Assignees for the following sections
MIT/Harvard students
Required
Committed Listeners
Required
In preparation for Week 2’s lecture on “DNA Read, Write, and Edit," please review these materials:
Lecture 2 slides as posted below.
The associated papers that are referenced in those slides.
In addition, answer these questions in each faculty member’s section:
Choose ONE of the following three questions to answer; and please cite AI prompts or paper citations used, if any.
[Using Google & Prof. Church’s slide #4] What are the 10 essential amino acids in all animals
and how does this affect your view of the “Lysine Contingency”?
[Given slides #2 & 4 (AA:NA and NA:NA codes)] What code would you suggest for AA:AA interactions?
[(Advanced students)] Given the one paragraph abstracts for these real 2026 grant programs
sketch a response to one of them or devise one of your own:
Assignment (Your HTGAA Website) — DUE BY START OF FEB 10 LECTURE
Assignees for the following sections
MIT/Harvard students
Required
Committed Listeners
Required
Begin personalizing your HTGAA website in in https://edit.htgaa.org/, starting with your homepage —
fill in the template with information about yourself, or remove what’s there and make it your own. Be creative!
As with all assignments in HTGAA, be sure to write up every part of this Homework on your HTGAA website in order to receive credit.
Synthetic Genomics: Options for Governance This is an older but useful report for thinking about a variety of options for the governance of biotechnology that inspired this week’s homework
National Security Commission on Emerging Biotechnology: This U.S. Congressional Commission will produce its first “comprehensive” report at the end of 2024 but has an “interim” 2023 report posted now, and they are currently soliciting input to guide national policy regulating biotech
iGEM 2020 Safety Hub: This page includes links to many useful resources including the WHO biosafety manual, the NIH guidelines and the CDC Biosafety in Microbial and Biomedical Laboratories Guide; additional information is available on the iGEM 2023 Responsibility page
Handbook for Community Biology Spaces: A handbook co-developed by community biolobabs, designed as a living document that can be updated and expanded by the community over time
DIYBio Ask a biosafety expert This page includes a portal where you can get your biosafety questions answered by professionals
Rooftop Solar and the Four Levers of Social Change: A blog post from Ethan Zuckerman considering different types of ways of regulating behavior, adopted in part from Lawrence Lessig’s book: Code 2.0, and explored in the context of energy consumption and production
Subsections of Week 1 (Feb 3)
Lab (Week 1) — Introduction to Pipetting and Dilutions
Overview
Objective
Welcome to HTGAA! This is our very first lab, and in this lab we will introduce students to the foundational techniques of pipetting and serial dilutions, critical for precise liquid handling and solution preparation in biological and chemical experiments.
This is a one-day lab with two protocols covered on mixing colors and dilution. By the end of the lab, students will confidently use pipettes, prepare solutions with desired concentrations, and troubleshoot common errors in pipetting.
Concepts Learned & Skills Gained
Students will:
Understand Units and Conversions: moles (mol), molarity (M), and conversions between µL, mL, and L.
Perform Serial Dilutions: Learn the stepwise dilution process to achieve specific solution concentrations.
Gain Pipetting Proficiency: Operate P20, P200, and P1000 pipettes accurately for volume transfers.
Visualize Mixing Outcomes: Use colors and absorbance measurements to observe concentration gradients.
Pre-Lab
Reading
Key Definitions
Here are some key definitions we’d like you to know before you get started.
Moles (mol): A unit representing $6.022 \times 10^{23}$ particles (atoms, molecules, etc.).
Molarity (M): Concentration defined as moles of solute per liter of solution (mol/L).
Conversions:
1 L = 1000 mL = 1,000,000 μL
1 M = 1000 mM = 1,000,000 μM
Planning Your Experiments
To calculate the volume of water needed for a dilution, use the formula: $$C_1 V_1 = C_2 V_2$$
$C_2$ : Final concentration (desired concentration).
$V_2$ : Final volume (total volume of the diluted solution).
Steps:
Rearrange the formula to calculate $V_1$: $$ V_1 = \frac{C_2 V_2}{C_1} $$
Calculate the volume of water (let’s call it $V_Water$) to add: $$ V_Water = V_2 - V_1 $$
Practice
Dilution Practice 1
Scenario: The stock concentration of a mystery substance (MS) is 5 M. Calculate how to dilute to 100 µM (0.1 mM):
Use sequential 1:499 and 1:99 dilution steps for accurate preparation.
Step 1: Dilute 5 M (5,000,000 µM) to 10,000 µM (500x dilution).
Step 2: Dilute 10,000 µM to 100 µM (100x dilution).
Dilution Practice 2
The stock concentration of a mystery substance (MS) is 5 M.
If the molar mass of MS is 532 g/mol, what’s the concentration of the stock concentration in g/mL? To make your life easier, you can use one of many online calculators.
You will perform a serial dilution to get 100 uM of MS. Devise a plan to dilute a 5 M MS solution to 100 uM. How many dilution steps will we need? Which tubes should we use? Which pipettes?
Fill out the following chart to prepare a final reaction with 60 uL reaction volume. Why did we make 100 uM MS if we actually need 40 uM MS? Why not prepare 40 uM in serial dilutions?
Reagent
Stock concentration
Desired concentration
Volume
Loading dye
6X
1X
MS
100 uM
40 uM
dH2O
n/a
n/a
Note
Please fill this out before coming to lab.
Additional resources
You must watch or be able to understand the following videos:
Mysterious substance (food coloring with water), henceforth: MS
Red, Blue and Yellow food coloring solutions
Gel loading dye (commonly used reagents for loading gels, strong purple color)
Part 1: Mixing Color
Prepare tubes with red, yellow, and blue food coloring solutions OR watercolor
Take ten tubes and mark them with numbers 1 to 6
Tube 1, 2 and 3: add 500 uL each red, yellow, and blue solution to the tube.
Tube 4: add 220 uL red solution to the tube, and add 220 uL yellow solution.
Try adding this in 2 steps: add 200 uL first, and then 20 uL. Discard your tips after you add one color!
Tube 5: add 525 uL yellow solution to the tube, and add 525 uL blue solution.
Tube 6: add 155 uL red solution to the tube, and add 155 uL blue solution.
Now you have a rainbow! You can try mixing other colors with the solutions.
Try plating different volumes (e.g. 1uL, 2uL, 5uL, 10uL) on a petri plate to make some designs and build your intuitive understanding of these volumes.
Part 2: Performing Serial Dilution
Perform serial dilutions to get 100 uM (0.1 mM) of MS.
Every time you mix in liquid, pipette up and down three or four times to ensure the two liquids are mixed thoroughly.
Mark each tube with its respective concentration using a pen.
Prepare a final reaction of 60 uL based on your table in the pre-lab.
Bonus: Take 20 uL from the final reaction and pipette it to a pre-prepared gel well. Wells are a bit trickier because they are thin and your pipette tip will puncture the gel if you’re not careful. Be gentle!
This week explores the read–write–edit toolkit: sequencing and synthesis workflows, restriction digests and gel electrophoresis, and early genome-editing frameworks.
Lecture (Tues, Feb 10)
DNA Read, Write, & Edit George Church [slides] Joe Jacobson Emily Leproust [slides]
(The recording will be posted here when available)
Recitation (Wed, Feb 11)
DNA Gel, restriction enzymes, Benchling intro, Twist intro Ice Kiattisewee
(The recording and slides will be posted here when available)
Make sure to document every step of the in-silico and lab experiments. Make sketches, screenshots, notes, drawings… anything that helps you - and others - understand the experiment.
Your Documentation should help you - and others - to understand the topic. Don’t be afraid to add things that don’t work. Show your failures - and how you overcame them. Your Documentation should be a description of the amazing journey you are on!
Assignees for the following sections
MIT/Harvard students
Required
Committed Listeners
Required
Part 0: Basics of Gel Electrophoresis
Attend or watch all lecture and recitation videos. Optionally watch bootcamp.
In recitation, we discussed that you will pick a protein for your homework that you find interesting. Which protein have you chosen and why? Using one of the tools described in recitation (NCBI, UniProt, google), obtain the protein sequence for the protein you chose.
[Example from our group homework, you may notice the particular format — The example below came from UniProt]
3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence.
The Central Dogma discussed in class and recitation describes the process in which DNA sequence becomes transcribed and translated into protein. The Central Dogma gives us the framework to work backwards from a given protein sequence and infer the DNA sequence that the protein is derived from. Using one of the tools discussed in class, NCBI or online tools (google “reverse translation tools”), determine the nucleotide sequence that corresponds to the protein sequence you chose above.
Lysis protein DNA sequence atggaaacccgattccctcagcaatcgcagcaaactccggcatctactaatagacgccggccattcaaacatgaggattacccatgtcgaagacaacaaagaagttcaactctttatgtattgatcttcctcgcgatctttctctcgaaatttaccaatcaattgcttctgtcgctactggaagcggtgatccgcacagtgacgactttacagcaattgcttacttaa
3.3. Codon optimization.
Once a nucleotide sequence of your protein is determined, you need to codon optimize your sequence. You may, once again, utilize google for a “codon optimization tool”. In your own words, describe why you need to optimize codon usage. Which organism have you chosen to optimize the codon sequence for and why?
Lysis protein DNA sequence with Codon-Optimization ATGGAAACCCGCTTTCCGCAGCAGAGCCAGCAGACCCCGGCGAGCACCAACCGCCGCCGCCCGTTCAAACATGAAGATTATCCGTGCCGTCGTCAGCAGCGCAGCAGCACCCTGTATGTGCTGATTTTTCTGGCGATTTTTCTGAGCAAATTCACCAACCAGCTGCTGCTGAGCCTGCTGGAAGCGGTGATTCGCACAGTGACGACCCTGCAGCAGCTGCTGACCTAA
3.4. You have a sequence! Now what?
What technologies could be used to produce this protein from your DNA? Describe in your words the DNA sequence can be transcribed and translated into your protein. You may describe either cell-dependent or cell-free methods, or both.
3.5. [Optional] How does it work in nature/biological systems?
Describe how does a single gene code for multiple proteins at the transcriptional level?
Try aligning the DNA sequence, the transcribed RNA, and also the resulting translated Protein!!! See example below.
[Example shows the biomolecular flow in central dogma from DNA to RNA to Protein] Special note that all “T” were transcribed into “U” and that the 3-nt codon represent 1-AA.
Rearranged snapshot of MS2 L-protein information flow from DNA to RNA to Protein. Captured from Ice’s Benchling and stitched together in a ppt
Part 4: DNA Read/Write/Edit
4.1 DNA Read
(i) What DNA would you want to sequence (e.g., read) and why? This could be DNA related to human health (e.g. genes related to disease research), environmental monitoring (e.g., sewage waste water, biodiversity analysis), and beyond (e.g. DNA data storage, biobank).
(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why? Also answer the following questions:
Is your method first-, second- or third-generation or other? How so?
What is your input? How do you prepare your input (e.g. fragmentation, adapter ligation, PCR)? List the essential steps.
What are the essential steps of your chosen sequencing technology, how does it decode the bases of your DNA sample (base calling)?
What is the output of your chosen sequencing technology?
4.2 DNA Write
(i) What DNA would you want to synthesize (e.g., write) and why? These could be individual genes, clusters of genes or genetic circuits, whole genomes, and beyond. As described in class thus far, applications could range from therapeutics and drug discovery (e.g., mRNA vaccines and therapies) to novel biomaterials (e.g. structural proteins), to sensors (e.g., genetic circuits for sensing and responding to inflammation, environmental stimuli, etc.), to art (DNA origamis). If possible, include the specific genetic sequence(s) of what you would like to synthesize! You will have the opportunity to actually have Twist synthesize these DNA constructs! :)
See some famous examples of DNA design
DNA origami by Paul W. K. Rothemund, California Institute of Technology, 2004. 100 nanometers in diameter.
(ii) What technology or technologies would you use to perform this DNA synthesis and why? Also answer the following questions:
What are the essential steps of your chosen sequencing methods?
What are the limitations of your sequencing method (if any) in terms of speed, accuracy, scalability?
4.3 DNA Edit
(i) What DNA would you want to edit and why? In class, George shared a variety of ways to edit the genes and genomes of humans and other organisms. Such DNA editing technologies have profound implications for human health, development, and even human longevity and human augmentation. DNA editing is also already commonly leveraged for flora and fauna, for example in nature conservation efforts, (animal/plant restoration, de-extinction), or in agriculture (e.g. plant breeding, nitrogen fixation). What kinds of edits might you want to make to DNA (e.g., human genomes and beyond) and why?
Colossal, Biosciences Inc., biotechnology company that leverages genetic engineering to working to de-extinct various historic animals, such as the woolly mammoth.
(ii) What technology or technologies would you use to perform these DNA edits and why? Also answer the following questions:
How does your technology of choice edit DNA? What are the essential steps?
What preparation do you need to do (e.g. design steps) and what is the input (e.g. DNA template, enzymes, plasmids, primers, guides, cells) for the editing?
What are the limitations of your editing methods (if any) in terms of efficiency or precision?
Reading & Resources (click to expand)
Resources
DNA Sequencing at 40: Past, Present, and Future (2017) Shendure, J., Balasubramanian, S., Church, G. et al.https://doi.org/10.1038/nature24286
Base editors contain a nicking or dead Cas9 enzyme fused to a deaminase.
a.) PAM requirement: Base editors contain a nicking or dead Cas9 enzyme fused to a deaminase. For designing your guide RNA for base editing you will therefore have a PAM requirement like you would have for any Cas9 experiment.
b.) Deamination window: An additional design constraint is that the sequence window in which deamination occurs is only a few base pairs long. You can find information on the deamination windows in the review below (even though some new editors are not included).
BE4 and ABE7.10 are good starting points and both use SpCas9 with NGG Pam requirement. Base editors with other PAM sites have been constructed too.
TALEN
For TALENs, you can assume no sequence restrictions – One of the technology’s previous restrictions was a T starting base, but this has since been overcome. In contrast to the CRISPR/Cas technologies above, your DNA sequence is recognized through interactions between the DNA and the TALEN: each TAL in the array recognizes one base.
(Note: In order to introduce a double strand break, you will need to design to TALENs targeting the opposing strands.)
Gel Purification of DNA: after DNA gel electrophoresis, cutting a band of DNA out of the agarose gel allows isolation and purification of a specific DNA fragment:
Week 7 — Genetic Circuits Part II: Neuromorphic Circuits
This week covers neuromorphic genetic circuits, showing how engineered gene networks can implement neural-network
“perceptron”-like computation and learning.
Lecture (Tues, Mar 17)
Genetic Circuits Part II: Neuromorphic Circuits Ron Weiss, Evan Holbrook
(The recording will be posted here when available)
This lecture presents a range of advanced technologies to do precision
measurement of proteins at atomic scales, characterizing chemical
composition, and detecting protein sequence and structure.
This week examines how modern bioproduction pipelines, from strain engineering to fermentation and downstream processing, are increasingly designed, executed, and optimized through cloud lab platforms and automation — enabling remote, high-throughput, and reproducible synthetic biology at industrial scale.
Lecture (Tues, Apr 14)
Bioproduction & Cloud Labs Reshma Shetty
(The recording will be posted here when available)
Recitation (Wed, Apr 15)
Cloud laboratories Ronan Donovan
(The recording and slides will be posted here when available)
This week covers designing, programming, and fabricating engineered living materials — such as self-healing concretes,
adaptive biofilms, and responsive biomaterials — by integrating genetic circuit design, materials science, and bioprocess
engineering.
Lecture (Tues, Apr 28)
Biodesign & Engineered Living Materials; Frugal Science Manu Prakash, David Kong
(The recording will be posted here when available)
Recitation (Wed, Apr 29)
Printing mycelium in Bambu Labs X1 Carbon 3D printer Ren Ramlan
(The recording and slides will be posted here when available)
Homework: Finish your Final Project Present it May 12 (MIT/Harvard) or May 13 (Committed Listeners)
Reading & Resources (click to expand)
Subsections of Week 14 (May 5)
Lab (Week 14) — Final Project Labwork
No Lab Assignment this week.
Final Project Lab time available
If your final project requires lab work, you can schedule a block of lab time this week.
Final Projects
Throughout the term each student defines and executes an Individual Final Project and then presents their work
before the class as a culmination of their semester. This applies to all students including local for-credit MIT/Harvard
students as well as the Global “Committed Listeners” who present their projects on Zoom to the Course Instructors, Lecturers and
Teaching Staff (note that this presentation is one of the requirements for Committed Listeners to earn a Certificate of
Completion for the course).
Info
May 12, 2026: MIT / Harvard Individual Final Project Presentations (~3 Hours)
May 13, 2026: Global Committed Listener Individual Final Project Presentations (~9-12 Hours)
In addition, all students have the opportunity to contribute to the Group Final Project, a collaborative effort
towards a significant research result which runs through the term and sometimes beyond.
For your Individual Final Project, write up your project and results on your HTGAA webpage following the guidelines below.
You will present your project from that online writeup; presentations should be 6 minutes for MIT/Harvard students and 3 minutes
for Global Committed Listeners, with 1-2 minutes of questions and discussion following.
Important Dates
Feb 25, 2026: Share 3 Individual Final Project ideas (1 slide each, in Google slide deck to be provided) Mar 18, 2026: Finalize Individual Final Project topic; send TAs Twist designs Apr 30 & May 1, 2026: Final project open Lab sessionn #1 (MIT/Harvard) May 7 & 8, 2026: Final project open Lab sessionn #2 (MIT/Harvard) May 12, 2026: MIT / Harvard Individual Final Project presentations (~3 Hours) May 13, 2026: Global Committed Listener Individual Final Project presentations (~9-12 Hours)
Links:
Links will be available later in the semester:
(Signup sheets for a presentation slot)
(A schedule of MIT/Harvard TA availability for lab work)
This content describes the 2025 (and ongoing) Group Final Project;
material here may be changed as the 2026 course progresses.
Phage Therapy
Phage therapy is the therapeutic use of bacteriophages to treat bacterial infections. Bacteriophages, or phages, are viruses that infect bacteria. They are highly specific, often infecting only a single strain of bacteria. Because of this specificity, phage therapy has potential advantages over traditional antibiotic treatment, which can kill beneficial bacteria along with the harmful ones. Phage therapy is seen as a solution to the problem of antibiotic resistance, which is becoming prevalent worldwide. At the current trend, in 26 years, the number of deaths attributed to antibiotic resistance are projected to become comparable with the number of deaths caused by cancer.
This project represents our HTGAA large-scale group research effort, where every participant has the opportunity to contribute to state-of-the-art research using advanced techniques. The potential impact of this work is significant, with the potential to make a real difference in people’s lives. For instance, consider the Patterson story, which highlights the transformative power of phage therapy. This Group Final Project is not just about academic advancement, but about making a tangible difference in the global fight against antibiotic resistance.
As evidenced in the Patterson story, a significant challenge in phage therapy is the ability of bacteria to rapidly develop resistance to the phages. In Patterson’s case, the initial phage cocktail became ineffective after a few days. Consequently, another cocktail was developed and administered. Once again, it became ineffective after a short period. It was not until the third cocktail was introduced that the patient was finally cured. This highlights the need for continual monitoring and adaptation in phage therapy, reflecting the dynamic nature of bacterial resistance.
You can find a detailed introduction into bacteria, phages and phage
therapy in our 2025 HTGAA Bootcamp Part 1
The Group Final Project
Despite the great advantages of phage therapy over conventional antibiotics, bacteriophages have a major limitation: Bacteria can develop ways to defend themselves against the phages and become resistant. But, in contrast to the static nature of antibiotics, phages have the power to evolve too. For billions of years, there has been an arms race between phages and bacteria. But now, with the development of new tools in synthetic biology such as protein engineering and the synthesis of new genomes harboring advantageous mutations, we can try to give the phages a head start. We attempt this by engineering their DNA or RNA, so they are prepared in case they encounter bacteria developing a resistance. This is the overall goal of the group final project. Specifically, we want to engineer the bacteriophage MS2 to be more prepared and more efficient in killing its host bacteria Escherichia coli (E. coli).
MS2 bacteriophage
MS2 bacteriophages infect E. coli bacteria with a high specificity. It is a very small virus consisting of coat proteins, a maturation protein and genetic material. They infect bacteria by attaching to the F-pilin protein on the host cell membrane and entering the cell. Once inside, the viral RNA acts as a messenger for phage protein production. All proteins for virion assembly are translated and the virus RNA is replicated. Next, new viruses form by assembling the coat and maturation proteins and encapsulating the virus RNA. Finally, a lysis protein expressed from the viral RNA triggers bacterial lysis by causing cell wall breakdown, whereby the new phages are released into the environment to infect new bacteria.
Empowering MS2 in their fight against E. coli
To make phages stronger against their host and to prepare them against host resistance, we can introduce mutations into their genes to slightly change the structure and/or function of the encoded proteins. Four genes are present on the MS2 RNA: 1. the maturation protein (A), 2. the coat protein (coat), 3. the lysis protein (L) and 4. the replicase (rep). For this course, we focus on the L gene encoding the lysis protein.
The exact function of the L protein is unknown, however, it is thought to form oligomers that can then integrate into the cell membrane to form pores, which ultimately lyse and kill the bacterial cell. This lysis protein is crucial for the phage to complete its life cycle and release new phages to infect more bacteria. Because of its importance, E. coli can try to intervene in the lysis protein production to stop the spread of the phages. For the translation and processing of the viral proteins, the phage heavily relies on the bacterial protein machinery. One example for such a protein is DnaJ, a chaperone responsible for proper protein folding, which has been shown to be important for MS2 lysis protein processing. E. coli can mutate this chaperone, preventing the lysis protein from interacting with DnaJ. This in turn causes the lysis protein to lose its function and stops MS2 from infecting more bacteria.
In this project, we want to engineer the lysis protein to increase the ability of MS2 to overcome potential E. coli resistance. We can attempt this by mutating the lysis protein to change its properties. Together, we aim for finding mutations that change the lysis protein one of the following ways: (1) an independence of lysis protein processing from DnaJ or other bacterial chaperones and (2) a faster or more efficient killing of E. coli to reduce the window in which the host can acquire resistance. In the course of this class, we will proceed through the following stages to create and test new MS2 phage mutants:
Stage 1: Engineer novel L protein mutants using protein design tools
Stage 2: Synthesize the L protein mutant gene via Twist
Stage 3: Clone the L protein mutant gene into a plasmid using Gibson Assembly
Stage 4: Test the L protein mutant’s structural integrity using the Nuclera system
Stage 5: Test the L protein in E. coli (details will follow)
With this group project, each student will have the opportunity to actively contribute to authentic scientific research that will advance scientific knowledge and could potentially have an impact on people’s lives.
![DNA-based digital data storage technology. Source: Archives in DNA: Workshop Exploring Implications of an Emerging Bio-Digital Technology through Design Fiction - Scientific Figure on ResearchGate. Available from: https://www.researchgate.net/figure/DNA-based-digital-data-storage-technology_fig1_353128454 [accessed 11 Feb 2025]](/2026a/course-pages/weeks/week-02/image4.png)
